Submissions:NABG Sequence Submission Portal

Nucleotide Page

Purpose

The purpose of the dnadb submission portal The “Nucleotide” Page is where you will provide your nucleotide sequence,information about the molecule type, and the physical form of the sequence. The information we ask for in this section includes:

The actual sequence(s) you are submitting

Whether you want the sequence available to the public or if you want it released on a particular date that you provide.

Whether the sequence is linear or circular

The Submission Release Date Section

When you click on the day you want the sequence released, that date will appear in the release date text box in the correct format Once the date appears in the release date text box, check to be sure you selected the correct date.

Molecule Type

You must indicate the type of molecule sequenced by picking a molecule type from the drop-down list of molecule types. You will not be able to submit your sequence(s) until you select a molecule type.

Topology

You must select topology from dropdown list.

Nucleotide Sequence and Definition Line

You can give us your sequence one of two ways: You can paste your sequence in FASTA format in the text box provided OR You can upload a file of FASTA formatted sequences from your computer directly to BankIt (Click the “Browse” button to find the file on your local computer, and click the “Upload” button to retrieve the file). Use only one of the above methods to give us your sequence. Do not paste your sequence into the text box and upload the sequence from your computer. If you do, you will get an error message and will not be allowed to submit unless you remove either the sequences you uploaded or the sequences you pasted in the text box.

The FASTA Format

The FASTA format includes a sequence ID, source information, a single-line description of the sequence (called the definition line), and the raw sequence data:>Seq1[organism=Carpodacus mexicanus]C.mexicanus clone 6b actin (act) mRNA,partial

cds
    CCTTTATCTAATCTTTGGAGCATGAGCTGGCATAGTTGGAACCGCCCTCAGCCTCCTCATCCGTGCAGAA
    CTTGGACAACCTGGAACTCTTCTAGGAGACGACCAAATTTACAATGTAATCGTCACTGCCCACGCCTTCG
    TAATAATTTTCTTTATAGTAATACCAATCATGATCGGTGGTTTCGGAAACTGACTAGTCCCACTCATAAT
    CGGCGCCCCCGACATAGCATTCCCCCGTATAAACAACATAAGCTTCTGACTACTTCCCCCATCATTTCTT
    TTACTTCTAGCATCCTCCACAGTAGAAGCTGGAGCAGGAACAGGGTGAACAGTATATCCCCCTCTCGCTG
    GTAACCTAGCCCATGCCGGTGCTTCAGTAGACCTAGCCATCTTCTCCCTCCACTTAGCAGGTGTTTCCTC
    TATCCTAGGTGCTATTAACTTTATTACAACCGCCATCAACATAAAACCCCCAACCCTCTCCCAATACCAA
    ACCCCCCTATTCGTATGATCAGTCCTTATTACCGCCGTCCTTCTCCTACTCTCTCTCCCAGTCCTCGCTG
    CTGGCATTACTATACTACTAACAGACCGAAACCTAAACACTACGTTCTTTGACCCAGCTGGAGGAGGAGA
    CCCAGTCCTGTACCAACACCTCTTCTGATTCTTCGGCCATCCAGAAGTCTATATCCTCATTTTAC

Organism

Once you begin entering the organism name in the text box provided,dnadb will provide a list of species names based on the text you enter,Select the appropriate organism name for your submission.